conda installation problem #432
Comments
|
pggb 0.3.0 is waaay too old! Can you try to specify the version?
conda install -c bioconda -c conda-forge pggb=0.7.2
After activating the new environment, verify that the new stuff was installed correctly with
conda list
…________________________________
From: HuangYihang1222 ***@***.***>
Sent: Sunday, December 1, 2024 21:54
To: pangenome/pggb ***@***.***>
Cc: Subscribed ***@***.***>
Subject: [pangenome/pggb] conda installation problem (Issue #432)
Hi,
Sorry to bother you guys and thank you for your excellent tool, but I've met some problems while installing it...
I've tried conda install -c bioconda pggb but it came with endless dependencies problems, so I tried conda install -c bioconda -c conda-forge pggb, but I got a 0.3.0 version of pggb.
When I did pggb -i "/home/huangyh/pangenome/in.fa" -o "/home/huangyh/pangenome/" -n 3 -t 8 -p 90 -s 5000 -V 'ref:50', the log file said "Command terminated by signal 4
wfmash -X -s 5000 -p 90 -n 3 -t 8 /home/huangyh/pangenome/in.fa /home/huangyh/pangenome/in.fa
0.02s user 0.18s system 703% cpu 0.03s total 13280Kb max memory", so I went to pggb issues to find out what cause the problem, seems that I need to update my pggb.
Then I tried manual installation, but I failed because of endless dependencies problems...
I wonder if it's my problem or maybe you can update pggb version through conda install -c bioconda -c conda-forge pggb? If so, that'd be so great!
Best regards,
Yihang
—
Reply to this email directly, view it on GitHub<#432>, or unsubscribe<https://github.com/notifications/unsubscribe-auth/AO26XHXESRI27WUKHNZUUQ32DPKWTAVCNFSM6AAAAABS2OSZNWVHI2DSMVQWIX3LMV43ASLTON2WKOZSG4YTAMZXHEYDSMQ>.
You are receiving this because you are subscribed to this thread.Message ID: ***@***.***>
|
|
Thank you for your so quick reply! I've tried your method and successfully got pggb 0.7.2 installed. However, when I tried to construct a pangenome, The program just exited without any warning or output... Here is part of my input fasta file: Best regards, |
|
Can I see your conda list?
________________________________
From: HuangYihang1222 ***@***.***>
Sent: Monday, December 2, 2024 19:53
To: pangenome/pggb ***@***.***>
Cc: Andrea Guarracino ***@***.***>; Comment ***@***.***>
Subject: Re: [pangenome/pggb] conda installation problem (Issue #432)
Thank you for your so quick reply! I've tried your method and successfully got pggb 0.7.2 installed.
However, when I tried to construct a pangenome,
#!/usr/bin/bash
# Construct a pangenome graph from a set of haplotypes using pggb
eval "$(conda shell.bash hook)"
conda activate pggb
pggb -i "/home/huangyh/pangenome/in.fa" -o "/home/huangyh/pangenome/" -n 3 -t 16 -p 90 -s 5000 -V 'ref:50'
The program just exited without any warning or output...
Here is part of my input fasta file:
CN#3#chr1
TAAAACTTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTTAAA
CTTTAAACTTTAAACTTTAAAACTTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTT
TAAACTTTAAACTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTTTAAAC
TTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTTTAAACTTGTAAACTTTACACACA
CACCCCCCCCCCCCCTTCTTTCTTCCCCTCTCTCTCACCCCACCCCCCACCCCCCACCCC
CCACCCCCCACCCCCCACCCCCCACCCCCCACCCCCCACCCCCCACCCCCACCCCCCACC
CCCCCCCACCCCCCACCCCCCACCCCCCACCCCCCACCCCCCACCCCCCCACCCCCCACC
CCCCACCCCCCACCCCCCACCCCCCACCCCCCCCCACCCCCCACCCCCCACCCCCCACCC
CCCACCCCCCACCCCCACCCCCCACCCCCACCCCCCCCACCCCCCACCCCCCACCCCACC
CCCCACCCCCACCCCCCACCCCCCACCCCCCCACCCCCCCCCACCCCCCACCCCCCACCC
CCCCACCCCCCACCCCCACCCCCCACCCCCCACCCCCCACCCCCACCCCCCACCCCCCAC
NA#1#chr2
GTACGGGCCCATTTTCACACCACTTTCTATTTTTAGCAGAAAACGTGCGATTTTTAAATC
GATTCACGCGTCAATTTGGTGAGTAATTACGCTACTCTGCAGCTTCCAGACTCAGTTTTT
GTGGCCTAAGAACACGTTTTGGCAAAAAAAAATCGAATTTTGGTTTTCGGAGGTGCGGGC
CCATTCTCACACCACTTTCTATTTTTAGCAGAAAACGTGCGATTTTTAAATCGATTCACG
CGTCAATTTGGTGAGTAATTACGCTACTCTGCAGCTTCCAGACTCAGTTTTTATGGCCTA
AGAACACGTTTTGGCAAAAAAAAATCGAATTTTGGTTTTCGGAGGTACGGGCCCATTTTT
ACACCACTTTCCATTTTTAGCAGAAAACGTGCGATTTTTAAATCGATTCTCGCGTCAATT
TCGTGAGTAATTACGCTACTCTGCAGCTTACAGACTCAGTTTTTATGGCCTAAGAACACG
NA#2#chr1
CACGAAATTAAATGGTCATAAGCTGGATGATCAGGCCCAAAAAGCTGTTAACACAGCAGG
CCCATTAAATTCTGGCGCTGATGTTGCTCCTTCTTCGAGTGGGCCACCTAAGGCCCAGAA
TGCTGGGCTTAATGTTAGTCAGAAGGGGACTGGGGTTTATATACCTGGTAATGGGCCGAT
CAGAAGCCCAGAACAGAAAAATGACACAGCGCTGAAGGCCCAATCTGTTACAACTTCTGG
GCCGATCAACAGCCCAAAGTTGAACACTTTGGATTCTTTGGGTTTTAAGGATTCTAATCC
TTTAATTGGGCCTATTGTTGGGCCTGAAAAGGATCCAAAAATGAAAGCTAAAGTGGATGG
Best regards,
Yihang
—
Reply to this email directly, view it on GitHub<#432 (comment)>, or unsubscribe<https://github.com/notifications/unsubscribe-auth/AO26XHUCGAE3LJZO6D2FM232DUFLLAVCNFSM6AAAAABS2OSZNWVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMZDKMJTGM3DKNRUGU>.
You are receiving this because you commented.Message ID: ***@***.***>
|
|
Sure,it looks like this: |
|
What is your operating system? Do you have a log file in /home/huangyh/pangenome/?
If you get nothing, it means that some step isn't working before you even start preparing the output folder and aligning sequences.
Andrea
…________________________________
From: HuangYihang1222 ***@***.***>
Sent: Monday, December 2, 2024 20:04
To: pangenome/pggb ***@***.***>
Cc: Andrea Guarracino ***@***.***>; Comment ***@***.***>
Subject: Re: [pangenome/pggb] conda installation problem (Issue #432)
Sure,it looks like this:
conda list
# packages in environment at /home/huangyh/anaconda3/envs/pggb:
#
# Name Version Build Channel
_libgcc_mutex 0.1 conda_forge conda-forge
_openmp_mutex 4.5 2_gnu conda-forge
annotated-types 0.6.0 py312h06a4308_0
arpack 3.9.1 nompi_h77f6705_101 conda-forge
bc 1.07.1 h7f98852_0 conda-forge
bcftools 1.21 h8b25389_0 bioconda
blas 1.0 openblas
brotli 1.0.9 h5eee18b_8
brotli-bin 1.0.9 h5eee18b_8
brotli-python 1.0.9 py312h6a678d5_8
bzip2 1.0.8 h5eee18b_6
c-ares 1.34.3 hb9d3cd8_1 conda-forge
ca-certificates 2024.11.26 h06a4308_0
certifi 2024.8.30 py312h06a4308_0
charset-normalizer 3.3.2 pyhd3eb1b0_0
click 8.1.7 py312h06a4308_0
cmake 3.31.1 hf9cb763_0 conda-forge
coloredlogs 15.0.1 py312h06a4308_2
colormath 3.0.0 py_2 conda-forge
contourpy 1.3.1 py312hdb19cb5_0
cycler 0.11.0 pyhd3eb1b0_0
eigen 3.2 3 bioconda
expat 2.6.4 h5888daf_0 conda-forge
font-ttf-dejavu-sans-mono 2.37 hd3eb1b0_0
font-ttf-inconsolata 2.001 hcb22688_0
font-ttf-source-code-pro 2.030 hd3eb1b0_0
font-ttf-ubuntu 0.83 h8b1ccd4_0
fontconfig 2.15.0 h7e30c49_1 conda-forge
fonts-anaconda 1 h8fa9717_0
fonttools 4.51.0 py312h5eee18b_0
freetype 2.12.1 h267a509_2 conda-forge
future 1.0.0 py312h06a4308_0
gdbm 1.18 hd4cb3f1_4
gfaffix 0.1.5b h031d066_0 bioconda
glpk 5.0 h445213a_0 conda-forge
gmp 6.3.0 hac33072_2 conda-forge
gsl 2.7 he715372_0
htslib 1.21 h5efdd21_0 bioconda
humanfriendly 10.0 py312h06a4308_1
humanize 3.10.0 pyhd3eb1b0_0
idna 3.7 py312h06a4308_0
importlib-metadata 8.5.0 py312h06a4308_0
jemalloc 4.5.0 0 bioconda
jinja2 3.1.4 py312h06a4308_1
jsoncpp 1.9.4 hdb19cb5_3
kaleido-core 0.2.1 h7c8854e_0
kiwisolver 1.4.4 py312h6a678d5_0
krb5 1.21.3 h143b758_0
lcms2 2.16 hb7c19ff_0 conda-forge
ld_impl_linux-64 2.40 h12ee557_0
lerc 4.0.0 h27087fc_0 conda-forge
libblas 3.9.0 25_linux64_openblas conda-forge
libbrotlicommon 1.0.9 h5eee18b_8
libbrotlidec 1.0.9 h5eee18b_8
libbrotlienc 1.0.9 h5eee18b_8
libcurl 8.10.1 hbbe4b11_0 conda-forge
libdeflate 1.21 h4bc722e_0 conda-forge
libedit 3.1.20230828 h5eee18b_0
libev 4.33 h7f8727e_1
libexpat 2.6.4 h5888daf_0 conda-forge
libffi 3.4.4 h6a678d5_1
libgcc 14.2.0 h77fa898_1 conda-forge
libgcc-ng 14.2.0 h69a702a_1 conda-forge
libgfortran 14.2.0 h69a702a_1 conda-forge
libgfortran-ng 14.2.0 h69a702a_1 conda-forge
libgfortran5 14.2.0 hd5240d6_1 conda-forge
libgomp 14.2.0 h77fa898_1 conda-forge
libiconv 1.17 hd590300_2 conda-forge
libidn2 2.3.4 h5eee18b_0
libjemalloc 5.3.0 h5888daf_1 conda-forge
libjpeg-turbo 3.0.3 h5eee18b_0
liblapack 3.9.0 25_linux64_openblas conda-forge
libnghttp2 1.64.0 h161d5f1_0 conda-forge
libnsl 2.0.1 hd590300_0 conda-forge
libopenblas 0.3.28 pthreads_h94d23a6_1 conda-forge
libpng 1.6.44 hadc24fc_0 conda-forge
libsqlite 3.47.0 hadc24fc_1 conda-forge
libssh2 1.11.1 hf672d98_0 conda-forge
libstdcxx 14.2.0 hc0a3c3a_1 conda-forge
libstdcxx-ng 14.2.0 h4852527_1 conda-forge
libtiff 4.7.0 h6565414_0 conda-forge
libunistring 0.9.10 h27cfd23_0
libuuid 2.38.1 h0b41bf4_0 conda-forge
libuv 1.49.2 hb9d3cd8_0 conda-forge
libwebp-base 1.4.0 hd590300_0 conda-forge
libxcb 1.17.0 h8a09558_0 conda-forge
libxcrypt 4.4.36 hd590300_1 conda-forge
libxml2 2.13.5 h064dc61_0 conda-forge
libzlib 1.3.1 hb9d3cd8_2 conda-forge
lzstring 1.0.4 py_1001 conda-forge
markdown 3.4.1 py312h06a4308_0
markdown-it-py 2.2.0 py312h06a4308_1
markupsafe 2.1.3 py312h5eee18b_0
mathjax 2.7.5 h06a4308_0
matplotlib-base 3.9.2 py312hbfdbfaf_1
mdurl 0.1.0 py312h06a4308_0
multiqc 1.22 pyhdfd78af_0 bioconda
ncurses 6.5 he02047a_1 conda-forge
networkx 3.3 py312h06a4308_0
nspr 4.35 h6a678d5_0
nss 3.105 hd34e28f_0 conda-forge
numpy 1.26.4 py312h2809609_0
numpy-base 1.26.4 py312he1a6c75_0
odgi 0.9.0 py312ha1f7cf2_0 bioconda
openjpeg 2.5.2 he7f1fd0_0
openssl 3.4.0 hb9d3cd8_0 conda-forge
packaging 24.1 py312h06a4308_0
perl 5.34.0 h5eee18b_2
pggb 0.7.2 h9ee0642_0 bioconda
pigz 2.8 h2797004_0 conda-forge
pillow 11.0.0 py312h7b63e92_0 conda-forge
pip 24.2 py312h06a4308_0
plotly 5.24.1 py312he106c6f_0
pthread-stubs 0.3 h0ce48e5_1
pyaml-env 1.2.1 pyhd8ed1ab_0 conda-forge
pybind11 2.13.6 py312hdb19cb5_0
pybind11-global 2.13.6 py312hdb19cb5_0
pydantic 2.8.2 py312h06a4308_0
pydantic-core 2.20.1 py312hb02cf49_0
pygments 2.15.1 py312h06a4308_1
pyparsing 3.2.0 py312h06a4308_0
pysocks 1.7.1 py312h06a4308_0
python 3.12.7 hc5c86c4_0_cpython conda-forge
python-dateutil 2.9.0post0 py312h06a4308_2
python-igraph 0.11.5 py312h4f72774_1 conda-forge
python-kaleido 0.2.1 py312h06a4308_0
python_abi 3.12 5_cp312 conda-forge
pyyaml 6.0.2 py312h5eee18b_0
readline 8.2 h5eee18b_0
requests 2.32.3 py312h06a4308_1
rhash 1.4.5 hb9d3cd8_0 conda-forge
rich 13.9.4 py312h06a4308_0
rich-click 1.8.3 pyhd8ed1ab_0 conda-forge
samtools 1.21 h50ea8bc_0 bioconda
seqwish 0.7.11 h43eeafb_0 bioconda
setuptools 75.1.0 py312h06a4308_0
simplejson 3.19.2 py312h5eee18b_0
six 1.16.0 pyhd3eb1b0_1
smoothxg 0.8.0 h40c17d1_0 bioconda
spectra 0.0.11 py_1 conda-forge
sqlite 3.31.1 h7b6447c_0
tabix 1.11 hdfd78af_0 bioconda
tabixpp 1.1.2 h27d5293_3 bioconda
tenacity 9.0.0 py312h06a4308_0
texttable 1.6.4 pyhd3eb1b0_0
time 1.9 hd590300_0 conda-forge
tk 8.6.13 noxft_h4845f30_101 conda-forge
tqdm 4.66.5 py312he106c6f_0
typeguard 4.2.1 py312h06a4308_0
typing-extensions 4.11.0 py312h06a4308_0
typing_extensions 4.11.0 py312h06a4308_0
tzdata 2024b h04d1e81_0
unicodedata2 15.1.0 py312h5eee18b_0
urllib3 2.2.3 py312h06a4308_0
vcfbub 0.1.1 h715e4b3_1 bioconda
vcflib 1.0.10 hdcf5f25_1 bioconda
vg 1.59.0 h9ee0642_0 bioconda
wfa2-lib 2.3.5 h4ac6f70_2 bioconda
wfmash 0.14.0 h11f254b_0 bioconda
wget 1.21.4 hda4d442_0 conda-forge
wheel 0.44.0 py312h06a4308_0
xorg-libxau 1.0.11 hb9d3cd8_1 conda-forge
xorg-libxdmcp 1.1.5 hb9d3cd8_0 conda-forge
xz 5.4.6 h5eee18b_1
yaml 0.2.5 h7b6447c_0
zipp 3.21.0 py312h06a4308_0
zlib 1.3.1 hb9d3cd8_2 conda-forge
zstd 1.5.6 ha6fb4c9_0 conda-forge
—
Reply to this email directly, view it on GitHub<#432 (comment)>, or unsubscribe<https://github.com/notifications/unsubscribe-auth/AO26XHQHQKPGJHYCIDOHCQL2DUGT3AVCNFSM6AAAAABS2OSZNWVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMZDKMJTGM3TSMJZGM>.
You are receiving this because you commented.Message ID: ***@***.***>
|
|
My operating system looks like this: When I firstly ran the program, the log file said this: So I reformatted my input fasta file again(and now it looks like I mentioned above) and did index again. Unfortunately, this time when I tried to run my program, nothing was written in my log file. |
|
I have the same issue, pggb program just exited without any warning or output on the screen, my pggb version is 0.7.2 and my operating system is Ubuntu 18.04.6 LTS. |
BTW, I tried to install PGGB by docker image and it works fine, so maybe conda installation has some problem. |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Hi,
Sorry to bother you guys and thank you for your excellent tool, but I've met some problems while installing it...
I've tried
conda install -c bioconda pggbbut it came with endless dependencies problems, so I triedconda install -c bioconda -c conda-forge pggb, but I got a 0.3.0 version of pggb.When I did
pggb -i "/home/huangyh/pangenome/in.fa" -o "/home/huangyh/pangenome/" -n 3 -t 8 -p 90 -s 5000 -V 'ref:50', the log file said "Command terminated by signal 4wfmash -X -s 5000 -p 90 -n 3 -t 8 /home/huangyh/pangenome/in.fa /home/huangyh/pangenome/in.fa
0.02s user 0.18s system 703% cpu 0.03s total 13280Kb max memory", so I went to pggb issues to find out what cause the problem, seems that I need to update my pggb.
Then I tried manual installation, but I failed because of endless dependencies problems...
I wonder if it's my problem or maybe you can update pggb version through
conda install -c bioconda -c conda-forge pggb? If so, that'd be so great!Best regards,
Yihang
The text was updated successfully, but these errors were encountered: