From 27f0e8348c6fde9bfff80d82a3b23257734a3f5f Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Wed, 14 Aug 2024 14:47:31 -0400
Subject: [PATCH 01/18] PD-2721: Add checks for empty cells (#1353)

---
 pipeline_versions.txt                     |  2 +-
 pipelines/skylab/snm3C/snm3C.changelog.md |  9 ++++--
 pipelines/skylab/snm3C/snm3C.wdl          | 34 +++++++++++++----------
 3 files changed, 28 insertions(+), 17 deletions(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index c80f1a60b..f8a8c4a1a 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -4,7 +4,7 @@ Multiome	 5.5.0	2024-08-06
 PairedTag	 1.5.0	2024-08-06 
 atac	 2.2.3	2024-08-02 
 SlideSeq	 3.4.0	2024-08-06 
-snm3C	 4.0.3	2024-08-05 
+snm3C	 4.0.4	2024-08-06 
 MultiSampleSmartSeq2SingleNucleus	 1.4.2	2024-08-25-02 
 scATAC	 1.3.2	2023-08-03 
 SmartSeq2SingleSample	 5.1.20	2023-04-19 
diff --git a/pipelines/skylab/snm3C/snm3C.changelog.md b/pipelines/skylab/snm3C/snm3C.changelog.md
index 7690c4ca2..91b7cab98 100644
--- a/pipelines/skylab/snm3C/snm3C.changelog.md
+++ b/pipelines/skylab/snm3C/snm3C.changelog.md
@@ -1,7 +1,12 @@
+# 4.0.4
+2024-08-06 (Date of Last Commit)
+
+* Updated the Demultiplexing task in the snm3C wdl to flag when file/cell is empty
+
 # 4.0.3
-2024-08-05 (Date of Last Commit)
+2024-08-06 (Date of Last Commit)
 
-* Updated the demultiplexing task in snm3C wdl to dynamically update the batch number based on the number of fastq files present
+* Updated the Demultiplexing task in snm3C wdl to dynamically update the batch number based on the number of fastq files present
 
 # 4.0.2
 2024-07-09 (Date of Last Commit)
diff --git a/pipelines/skylab/snm3C/snm3C.wdl b/pipelines/skylab/snm3C/snm3C.wdl
index 953d9912f..b7387032f 100644
--- a/pipelines/skylab/snm3C/snm3C.wdl
+++ b/pipelines/skylab/snm3C/snm3C.wdl
@@ -44,7 +44,7 @@ workflow snm3C {
     }
 
     # version of the pipeline
-    String pipeline_version = "4.0.3"
+    String pipeline_version = "4.0.4"
 
     call Demultiplexing {
         input:
@@ -154,6 +154,8 @@ task Demultiplexing {
     File random_primer_indexes
     String plate_id
     Int batch_number
+    Int min_threshold = 100
+    Int max_threshold = 10000000
     String docker
 
     Int disk_size = 1000
@@ -179,7 +181,7 @@ task Demultiplexing {
     $WORKING_DIR/r2.fastq.gz \
     > $WORKING_DIR/~{plate_id}.stats.txt
 
-    # remove the fastq files that end in unknown-R1.fq.gz and unknown-R2.fq.gz
+    # Remove the fastq files that end in unknown-R1.fq.gz and unknown-R2.fq.gz
     rm $WORKING_DIR/*-unknown-R{1,2}.fq.gz
 
     python3 <<CODE
@@ -199,27 +201,31 @@ task Demultiplexing {
         trimmed_count = int(adapter_match[1])
         adapter_counts[adapter_name] = trimmed_count
 
-    # Removing fastq files with trimmed reads greater than 30
-    threshold = 10000000
-
+    # Removing fastq files with trimmed reads greater than 10000000 or less than 100
     for filename in os.listdir(working_dir):
         if filename.endswith('.fq.gz'):
             file_path = os.path.join(working_dir, filename)
-            adapter_name = re.search(r'A(\d+)-R', filename)
+            adapter_name = re.search(r'([A-Za-z]\d+)-R', filename).group(1)
             if adapter_name:
-                adapter_name = 'A' + adapter_name.group(1)
-                if adapter_name in adapter_counts and adapter_counts[adapter_name] > threshold:
-                    os.remove(file_path)
+                if adapter_name in adapter_counts:
+                    if adapter_counts[adapter_name] < ~{min_threshold} or adapter_counts[adapter_name] > ~{max_threshold}:
+                        print("Removing ", file_path, " with count equal to ", adapter_counts[adapter_name])
+                        os.remove(file_path)
     CODE
+    
+    # Check if the number of *R1.fq.gz files is 0
+    if [[ $(ls | grep "\-R1.fq.gz" | wc -l) -eq 0 ]]; then
+        echo "Error: No files found. All fastq files were removed. Exiting."
+        exit 1
+    fi
 
     # Batch the fastq files into folders of batch_number size
     R1_files=($(ls $WORKING_DIR | grep "\-R1.fq.gz"))
     R2_files=($(ls $WORKING_DIR | grep "\-R2.fq.gz"))
+    batch_number=~{batch_number}
     total_files=${#R1_files[@]}
     echo "Total files: $total_files"
 
-    batch_number=~{batch_number}
-
     if [[ $total_files -lt $batch_number ]]; then
         echo "Warning: Number of files is less than the batch number. Updating batch number to $total_files."
         batch_number=$total_files
@@ -229,14 +235,14 @@ task Demultiplexing {
         mkdir -p "batch${i}"  # Combine batch and i, use -p to create parent dirs
     done
 
-    # Counter for the folder index
+    # Counter for the folder index and create emptycells file
     folder_index=1
-    WORKING_DIR=`pwd`
 
     # Distribute the FASTQ files and create TAR files
     for file in "${R1_files[@]}"; do
         sample_id=$(basename "$file" "-R1.fq.gz")
         r2_file="${sample_id}-R2.fq.gz"
+         
         mv $WORKING_DIR/$file batch$((folder_index))/$file
         mv $WORKING_DIR/$r2_file batch$((folder_index))/$r2_file
         # Increment the counter
@@ -249,7 +255,7 @@ task Demultiplexing {
         tar -cf - $WORKING_DIR/batch${i}/*.fq.gz | pigz > ~{plate_id}.${i}.cutadapt_output_files.tar.gz
     done
   >>>
-
+  
   runtime {
     docker: docker
     disks: "local-disk ${disk_size} SSD"

From c350acb1321e60b45c138cdb979cfd7ca53b47a8 Mon Sep 17 00:00:00 2001
From: Nikelle Petrillo <38223776+nikellepetrillo@users.noreply.github.com>
Date: Thu, 15 Aug 2024 12:59:07 -0400
Subject: [PATCH 02/18] Np add firecloud api scripts (#1358)

* pin all latest docker version

* add firecloud scripts

* add testing scripts
---
 scripts/firecloud_api/GetWorkflowOutputs.py   | 53 +++++++++++
 .../SubmitWorkflowAndGetStatus.py             | 90 +++++++++++++++++++
 2 files changed, 143 insertions(+)
 create mode 100644 scripts/firecloud_api/GetWorkflowOutputs.py
 create mode 100644 scripts/firecloud_api/SubmitWorkflowAndGetStatus.py

diff --git a/scripts/firecloud_api/GetWorkflowOutputs.py b/scripts/firecloud_api/GetWorkflowOutputs.py
new file mode 100644
index 000000000..8970a888d
--- /dev/null
+++ b/scripts/firecloud_api/GetWorkflowOutputs.py
@@ -0,0 +1,53 @@
+import requests
+import argparse
+
+def get_workflow_outputs(token, namespace, workspace_name, submission_id, workflow_id, pipeline_name):
+    # API endpoint to get the workflow outputs
+    url = f"https://api.firecloud.org/api/workspaces/{namespace}/{workspace_name}/submissions/{submission_id}/workflows/{workflow_id}/outputs"
+    print(f"Requesting URL: {url}")
+
+    # Headers including the authorization token
+    headers = {
+        'accept': '*/*',
+        'Authorization': f'Bearer {token}',
+    }
+
+    # Make the GET request
+    response = requests.get(url, headers=headers)
+
+    # Check if the request was successful
+    if response.status_code == 200:
+        json_response = response.json()  # parse the JSON response
+        # extract the outputs section using the task name
+        outputs = json_response.get('tasks', {}).get(pipeline_name, {}).get('outputs', {})
+
+        # Turn the outputs dictionary into a list of values
+        output_values = list(outputs.values())
+
+        return outputs, output_values
+    else:
+        print(f"Failed to retrieve workflow outputs. Status code: {response.status_code}")
+        return None, None
+
+if __name__ == "__main__":
+    # Define the command-line arguments
+    parser = argparse.ArgumentParser(description='Fetch workflow outputs from the API.')
+    parser.add_argument('--token', required=True, help='Authentication token')
+    parser.add_argument('--namespace', required=True, help='Workspace namespace')
+    parser.add_argument('--workspace', required=True, help='Workspace name')
+    parser.add_argument('--submission_id', required=True, help='Submission ID')
+    parser.add_argument('--workflow_id', required=True, help='Workflow ID')
+    parser.add_argument('--pipeline_name', required=True, help='Name of the pipeline')
+
+    # Parse the arguments
+    args = parser.parse_args()
+
+    # Call the function with the parsed arguments
+    outputs, output_values = get_workflow_outputs(args.token, args.namespace, args.workspace, args.submission_id, args.workflow_id, args.pipeline_name)
+
+    if outputs:
+        print("Outputs:")
+        print(outputs)
+
+        print("\nOutput Values:")
+        print(output_values)
\ No newline at end of file
diff --git a/scripts/firecloud_api/SubmitWorkflowAndGetStatus.py b/scripts/firecloud_api/SubmitWorkflowAndGetStatus.py
new file mode 100644
index 000000000..3276bf415
--- /dev/null
+++ b/scripts/firecloud_api/SubmitWorkflowAndGetStatus.py
@@ -0,0 +1,90 @@
+import requests
+import time
+import argparse
+import json
+
+def create_submission(token, workspace_namespace, workspace_name, submission_data):
+    # API endpoint
+    base_url = f'https://api.firecloud.org/api/workspaces/{workspace_namespace}/{workspace_name}/submissions'
+
+    # Headers to make API requests
+    headers = {
+        'accept': 'application/json',
+        'Authorization': f'Bearer {token}',
+        'Content-Type': 'application/json'
+    }
+
+    # Create the submission
+    # send an HTTP POST request to the API endpoint
+    response = requests.post(base_url, headers=headers, json=submission_data)
+    # convert the response json into a dictionary
+    submission_response = response.json()
+    # extract the submission ID from the response dictionary
+    submission_id = submission_response.get("submissionId")
+
+    if not submission_id:
+        print("Failed to create submission.")
+    else:
+        print(f"Submission created with ID: {submission_id}")
+        return submission_id
+
+def poll_submission_status(token, workspace_namespace, workspace_name, submission_id):
+
+    # Status endpoint
+    status_url = f'https://api.firecloud.org/api/workspaces/{workspace_namespace}/{workspace_name}/submissions/{submission_id}'
+
+    # Headers to make API requests
+    headers = {
+        'accept': 'application/json',
+        'Authorization': f'Bearer {token}'
+    }
+
+    # polling the submission status
+    # create an emptu list to store the previous workflow status
+    previous_workflow_status = []
+
+    # loop until the submission is done
+    while True:
+        # send a get request and convert the response json into a dictionary
+        status_response = requests.get(status_url, headers=headers)
+        status_data = status_response.json()
+
+        # get the submission status
+        submission_status = status_data.get("status")
+        # get the workflow status of each workflow in the submission
+        workflows_status = [workflow.get("status") for workflow in status_data.get("workflows", [])]
+
+        # print the workflow status to stdout if it has changed
+        if workflows_status != previous_workflow_status:
+            print(f"Workflows Status: {workflows_status}")
+            previous_workflow_status = workflows_status
+
+        # Check if the submission has completed
+        if submission_status == "Done" and "Failed" in workflows_status:
+            print("At least one workflow has failed.")
+            break
+        elif submission_status == "Done":
+            break
+
+        # Wait for 10 seconds before polling again
+        time.sleep(10)
+
+if __name__ == "__main__":
+    parser = argparse.ArgumentParser(description='Submit and monitor a job.')
+    parser.add_argument('--token', required=True, help='API access token')
+    parser.add_argument('--workspace-namespace', required=True, help='Workspace namespace')
+    parser.add_argument('--workspace-name', required=True, help='Workspace name')
+    parser.add_argument('--submission-data-file', required=True, help='Path to the JSON file containing submission data')
+
+    args = parser.parse_args()
+
+    # load submission data from JSON file
+    with open(args.submission_data_file, 'r') as file:
+        submission_data = json.load(file)
+
+    # create submission and get submission ID
+    submission_id = create_submission(args.token, args.workspace_namespace, args.workspace_name, submission_data)
+
+    if submission_id:
+        # Poll submission status
+        poll_submission_status(args.token, args.workspace_namespace, args.workspace_name, submission_id)

From bb5d9c2a032a361734d56b51ee5b7edcc3f911b1 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Wed, 28 Aug 2024 15:30:25 -0400
Subject: [PATCH 03/18] adding 10x wrapper function

---
 pipelines/skylab/atac/atac.wdl | 36 ++++++++++++++++++++++++++++++----
 1 file changed, 32 insertions(+), 4 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 45f6a7175..9ed8ce532 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -58,7 +58,7 @@ workflow ATAC {
   String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919"
   String samtools_docker = "samtools-dist-bwa:3.0.0"
   String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311"
-  String snap_atac_docker = "snapatac2:1.0.9-2.6.3-1715865353"
+  String snap_atac_docker = "snapatac2:lk-PD-2738"
 
   # Make sure either 'gcp' or 'azure' is supplied as cloud_provider input. If not, raise an error
   if ((cloud_provider != "gcp") && (cloud_provider != "azure")) {
@@ -158,11 +158,13 @@ workflow ATAC {
   File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output])
   File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
   File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics])
+  File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics])
 
   output {
     File bam_aligned_output = bam_aligned_output_atac
     File fragment_file = fragment_file_atac
     File snap_metrics = snap_metrics_atac
+    File library_metrics_file = library_metrics
   }
 }
 
@@ -547,13 +549,38 @@ task CreateFragmentFile {
     import snapatac2.preprocessing as pp
     import snapatac2 as snap
     import anndata as ad
+    from collections import OrderedDict
+    import csv
 
     # extract CB or BB (if preindex is true) tag from bam file to create fragment file
     if preindex == "true":
-      pp.make_fragment_file("~{bam}", "~{bam_base_name}.fragments.tsv", is_paired=True, barcode_tag="BB")
+      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     elif preindex == "false":
-      pp.make_fragment_file("~{bam}", "~{bam_base_name}.fragments.tsv", is_paired=True, barcode_tag="CB")
-      
+      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
+    
+    # Add NHashID to metrics 
+    nhash_ID_value = "XXX"
+    data = OrderedDict({'NHash_ID': atac_nhash_id, **data})
+    # Flatten the dictionary
+    flattened_data = []
+    for category, metrics in data.items():
+        if isinstance(metrics, dict):
+            for metric, value in metrics.items():
+                flattened_data.append((metric, value))
+        else:
+            flattened_data.append((category, metrics))
+
+    # Write to CSV
+    csv_file_path = "~{bam_base_name}_~{atac_nhash}.atac_metrics.csv"
+    with open(csv_file_path, mode='w', newline='') as file:
+        writer = csv.writer(file)
+        writer.writerow(['Metric', 'Value'])  # Write header
+        writer.writerows(flattened_data)  # Write data
+
+    print(f"Dictionary successfully written to {csv_file_path}")
+
+
+
 
     # calculate quality metrics; note min_num_fragments and min_tsse are set to 0 instead of default
     # those settings allow us to retain all barcodes
@@ -580,5 +607,6 @@ task CreateFragmentFile {
   output {
     File fragment_file = "~{bam_base_name}.fragments.tsv"
     File Snap_metrics = "~{bam_base_name}.metrics.h5ad"
+    File atac_library_metrics = "~{bam_base_name}_~{atac_nhash}.atac_metrics.csv"
   }
 }

From 6340acad47835658f264af02fe62c36067eb618d Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Wed, 28 Aug 2024 15:34:04 -0400
Subject: [PATCH 04/18] fixing nhash_id variable

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 9ed8ce532..67166fbcf 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -571,7 +571,7 @@ task CreateFragmentFile {
             flattened_data.append((category, metrics))
 
     # Write to CSV
-    csv_file_path = "~{bam_base_name}_~{atac_nhash}.atac_metrics.csv"
+    csv_file_path = "~{bam_base_name}_~{atac_nhash_id}.atac_metrics.csv"
     with open(csv_file_path, mode='w', newline='') as file:
         writer = csv.writer(file)
         writer.writerow(['Metric', 'Value'])  # Write header
@@ -607,6 +607,6 @@ task CreateFragmentFile {
   output {
     File fragment_file = "~{bam_base_name}.fragments.tsv"
     File Snap_metrics = "~{bam_base_name}.metrics.h5ad"
-    File atac_library_metrics = "~{bam_base_name}_~{atac_nhash}.atac_metrics.csv"
+    File atac_library_metrics = "~{bam_base_name}_~{atac_nhash_id}.atac_metrics.csv"
   }
 }

From ae011ccd51b4f83545c038a15fd6fc2d6fc9dcb0 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 08:27:37 -0400
Subject: [PATCH 05/18] added h5ad output

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 67166fbcf..c39af5fb2 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -554,7 +554,7 @@ task CreateFragmentFile {
 
     # extract CB or BB (if preindex is true) tag from bam file to create fragment file
     if preindex == "true":
-      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
+      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     elif preindex == "false":
       data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     

From 9e91e40cb0d4e8e7a789edc4ba8814022b455e39 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 09:24:19 -0400
Subject: [PATCH 06/18] adding h5ad argument to second command

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index c39af5fb2..e1abc0aac 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -556,7 +556,7 @@ task CreateFragmentFile {
     if preindex == "true":
       data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     elif preindex == "false":
-      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
+      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     
     # Add NHashID to metrics 
     nhash_ID_value = "XXX"

From f553620e650aeac4d791de445ade178212b099de Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 09:24:53 -0400
Subject: [PATCH 07/18] removing temp metrics

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index e1abc0aac..a07f4c2a7 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -584,7 +584,7 @@ task CreateFragmentFile {
 
     # calculate quality metrics; note min_num_fragments and min_tsse are set to 0 instead of default
     # those settings allow us to retain all barcodes
-    pp.import_data("~{bam_base_name}.fragments.tsv", file="temp_metrics.h5ad", chrom_sizes=chrom_size_dict, min_num_fragments=0)
+   
     atac_data = ad.read_h5ad("temp_metrics.h5ad")
     # Add nhash_id to h5ad file as unstructured metadata
     atac_data.uns['NHashID'] = atac_nhash_id

From 9f62353ab347735f489109502742e6ce90eef3e2 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 09:41:36 -0400
Subject: [PATCH 08/18] Update atac.wdl

---
 pipelines/skylab/atac/atac.wdl | 6 ------
 1 file changed, 6 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index a07f4c2a7..b5d2b3f02 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -579,12 +579,6 @@ task CreateFragmentFile {
 
     print(f"Dictionary successfully written to {csv_file_path}")
 
-
-
-
-    # calculate quality metrics; note min_num_fragments and min_tsse are set to 0 instead of default
-    # those settings allow us to retain all barcodes
-   
     atac_data = ad.read_h5ad("temp_metrics.h5ad")
     # Add nhash_id to h5ad file as unstructured metadata
     atac_data.uns['NHashID'] = atac_nhash_id

From 2e597da2d3a2c41ab326d87e06ba05a7d012a61c Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 09:48:45 -0400
Subject: [PATCH 09/18] removing header in ATAC and starting documentation for
 metrics

---
 pipelines/skylab/atac/atac.wdl                 |  1 -
 website/docs/Pipelines/ATAC/library-metrics.md | 12 ++++++++++++
 2 files changed, 12 insertions(+), 1 deletion(-)
 create mode 100644 website/docs/Pipelines/ATAC/library-metrics.md

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index b5d2b3f02..5fcb3ffa7 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -574,7 +574,6 @@ task CreateFragmentFile {
     csv_file_path = "~{bam_base_name}_~{atac_nhash_id}.atac_metrics.csv"
     with open(csv_file_path, mode='w', newline='') as file:
         writer = csv.writer(file)
-        writer.writerow(['Metric', 'Value'])  # Write header
         writer.writerows(flattened_data)  # Write data
 
     print(f"Dictionary successfully written to {csv_file_path}")
diff --git a/website/docs/Pipelines/ATAC/library-metrics.md b/website/docs/Pipelines/ATAC/library-metrics.md
new file mode 100644
index 000000000..a16db5b9d
--- /dev/null
+++ b/website/docs/Pipelines/ATAC/library-metrics.md
@@ -0,0 +1,12 @@
+---
+sidebar_position: 2
+---
+
+# ATAC Library Metrics Overview
+
+The [ATAC pipeline](README.md) uses [SnapATAC2](https://github.com/kaizhang/SnapATAC2) to generate library-level metrics in CSV format.  
+
+
+| Metric | Description |
+| --- | --- | 
+

From 1941d99c4ce927e11c626e4b824ff32a90f04e8b Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 09:53:35 -0400
Subject: [PATCH 10/18] added metric definitions to the library overview

---
 .../docs/Pipelines/ATAC/library-metrics.md    | 25 ++++++++++++++++++-
 1 file changed, 24 insertions(+), 1 deletion(-)

diff --git a/website/docs/Pipelines/ATAC/library-metrics.md b/website/docs/Pipelines/ATAC/library-metrics.md
index a16db5b9d..184cfeb8e 100644
--- a/website/docs/Pipelines/ATAC/library-metrics.md
+++ b/website/docs/Pipelines/ATAC/library-metrics.md
@@ -8,5 +8,28 @@ The [ATAC pipeline](README.md) uses [SnapATAC2](https://github.com/kaizhang/Snap
 
 
 | Metric | Description |
-| --- | --- | 
+| --- | --- |
+| NHash_ID | A unique identifier used to track and reference the specific sample or dataset. |
+| Sequenced_reads | The total number of reads generated from the sequencing process, which includes both reads that are mapped and unmapped. |
+| Sequenced_read_pairs | The total number of read pairs (two reads per pair) generated from the sequencing process. This is typically half of the total sequenced reads if all reads are paired. |
+| Fraction_valid_barcode | The fraction of reads that contain a valid barcode, indicating the proportion of reads that are correctly assigned to a specific cell or sample. |
+| Fraction_Q30_bases_in_read_1 | The proportion of bases in Read 1 that have a Phred quality score of 30 or higher, indicating high-confidence base calls. |
+| Fraction_Q30_bases_in_read_2 | The proportion of bases in Read 2 that have a Phred quality score of 30 or higher, indicating high-confidence base calls. |
+| Number_of_cells | The estimated number of cells captured and sequenced in the experiment, based on the barcodes identified. |
+| Mean_raw_read_pairs_per_cell | The average number of raw read pairs associated with each cell, providing an indication of the sequencing depth per cell. |
+| Median_high-quality_fragments_per_cell | The median number of high-quality (e.g., confidently mapped) fragments associated with each cell, representing typical fragment quality across cells. |
+| Fraction of high-quality fragments in cells | The fraction of high-quality fragments that are associated with identified cells, indicating the proportion of good-quality data that is cell-associated. |
+| Fraction_of_transposition_events_in_peaks_in_cells | The fraction of transposition events within identified cells that occur within peaks, which are regions of accessible chromatin. |
+| Fraction_duplicates | The fraction of sequenced fragments that are duplicates, which can result from PCR amplification or other factors, indicating the redundancy in the sequencing data. |
+| Fraction_confidently_mapped | The fraction of sequenced fragments that are confidently mapped to the reference genome, indicating the proportion of reads that align well to the genome. |
+| Fraction_unmapped | The fraction of sequenced fragments that could not be mapped to the reference genome, which can indicate sequencing errors, contamination, or regions not covered by the reference. |
+| Fraction_nonnuclear | The fraction of sequenced fragments that are mapped to non-nuclear (e.g., mitochondrial or other organellar) DNA, providing insight into contamination or organellar activity. |
+| Fraction_fragment_in_nucleosome_free_region | The fraction of sequenced fragments that map to nucleosome-free regions, which are indicative of accessible chromatin. |
+| Fraction_fragment_flanking_single_nucleosome | The fraction of sequenced fragments that map to regions flanking single nucleosomes, indicating regions with partial chromatin accessibility. |
+| TSS_enrichment_score | A measure of the enrichment of transposition events at transcription start sites (TSS), indicating the accessibility of promoters across the genome. |
+| Fraction_of_high-quality_fragments_overlapping_TSS | The fraction of high-quality fragments that overlap transcription start sites (TSS), providing insight into promoter accessibility. |
+| Number_of_peaks | The total number of peaks, or regions of accessible chromatin, identified in the dataset, representing potential regulatory elements. |
+| Fraction_of_genome_in_peaks | The fraction of the genome that is covered by identified peaks, indicating the extent of chromatin accessibility across the genome. |
+| Fraction_of_high-quality_fragments_overlapping_peaks | The fraction of high-quality fragments that overlap with identified peaks, providing an indication of the efficiency of the assay in capturing accessible regions. |
+
 

From 0523b89bfef6693bceeb9f0696fbf88052987e77 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 12:33:18 -0400
Subject: [PATCH 11/18] updating Multiome documentation and outputs with new
 ATAC metrics

---
 pipelines/skylab/multiome/Multiome.wdl             | 1 +
 website/docs/Pipelines/ATAC/README.md              | 1 +
 website/docs/Pipelines/Multiome_Pipeline/README.md | 1 +
 3 files changed, 3 insertions(+)

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 21584c01d..0ecb33aa2 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -179,6 +179,7 @@ workflow Multiome {
         File fragment_file_atac = JoinBarcodes.atac_fragment_tsv
         File fragment_file_index = JoinBarcodes.atac_fragment_tsv_tbi
         File snap_metrics_atac = JoinBarcodes.atac_h5ad_file
+        File atac_library_metrics = Atac.library_metrics
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version
diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index 1bb2dd639..fc3a985ab 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -93,6 +93,7 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | bam_aligned_output | `<input_id>`.bam | BAM containing aligned reads from ATAC workflow. |
 | fragment_file | `<input_id>`.fragments.tsv | TSV containing fragment start and stop coordinates per barcode. In order, the columns are "Chromosome", "Start", "Stop", "ATAC Barcode", and "Number Reads". | 
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
+ library_metrics | `<input_id>`_`<atac_nhash_id>`.atac_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md)
 
 ## Versioning and testing
 
diff --git a/website/docs/Pipelines/Multiome_Pipeline/README.md b/website/docs/Pipelines/Multiome_Pipeline/README.md
index d77c5ec3b..afb277766 100644
--- a/website/docs/Pipelines/Multiome_Pipeline/README.md
+++ b/website/docs/Pipelines/Multiome_Pipeline/README.md
@@ -107,6 +107,7 @@ The Multiome workflow calls two WARP subworkflows, one external subworkflow (opt
 | fragment_file_atac | `<input_id>_atac.fragments.sorted.tsv.gz` | Sorted and bgzipped TSV file containing fragment start and stop coordinates per barcode. The columns are "Chromosome", "Start", "Stop", "ATAC Barcode", "Number of reads", and "GEX Barcode". | 
 | fragment_file_index |  `<input_id>_atac.fragments.sorted.tsv.gz.tbi` | tabix index file for the fragment file. |
 | snap_metrics_atac | `<input_id>_atac.metrics.h5ad` | h5ad (Anndata) file containing per-barcode metrics from SnapATAC2. Also contains the equivalent gene expression barcode for each ATAC barcode in the `gex_barcodes` column of the `h5ad.obs` property. See the [ATAC Count Matrix Overview](../ATAC/count-matrix-overview.md) for more details. |
+| atac_library_metrics | `<input_id>_<nhash_id>.atac.metrics.csv` | CSV with library-level metrics produced by SnapATAC2. See the ATAC [Library Level Metrics Overview](../ATAC/library-metrics.md) for more details. |
 | genomic_reference_version_gex | `<reference_version>.txt` | File containing the Genome build, source and GTF annotation version. |
 | bam_gex | `<input_id>_gex.bam` | BAM file containing aligned reads from Optimus workflow. |
 | matrix_gex | `<input_id>_gex_sparse_counts.npz` | NPZ file containing raw gene by cell counts. |

From 17b2f94507b9efcf6f1b8b50188888fc8aeaa67c Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 12:46:44 -0400
Subject: [PATCH 12/18] updated changelogs, pipeline ersions, and final outputs

---
 pipelines/skylab/atac/atac.changelog.md            | 5 +++++
 pipelines/skylab/atac/atac.wdl                     | 2 +-
 pipelines/skylab/multiome/Multiome.changelog.md    | 5 +++++
 pipelines/skylab/multiome/Multiome.wdl             | 4 ++--
 pipelines/skylab/paired_tag/PairedTag.changelog.md | 5 +++++
 pipelines/skylab/paired_tag/PairedTag.wdl          | 4 +++-
 6 files changed, 21 insertions(+), 4 deletions(-)

diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
index ffe875fa0..1207b32c1 100644
--- a/pipelines/skylab/atac/atac.changelog.md
+++ b/pipelines/skylab/atac/atac.changelog.md
@@ -1,3 +1,8 @@
+# 2.3.0
+2024-08-29 (Date of Last Commit)
+
+* Updated the SnapATAC2 docker to include v2.7.0; the pipeline will now produce a library-level summary metric CSV for the BAM.  
+
 # 2.2.3
 2024-08-02 (Date of Last Commit)
 
diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 5fcb3ffa7..bc4d0c11f 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -46,7 +46,7 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.2.3"
+  String pipeline_version = "2.3.0"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
index afc52d57f..98904837e 100644
--- a/pipelines/skylab/multiome/Multiome.changelog.md
+++ b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,3 +1,8 @@
+# 5.6.0
+2024-08-02 (Date of Last Commit)
+
+* Updated the SnapATAC2 docker to include v2.7.0; the pipeline will now produce a library-level summary metric CSV for the BAM.
+
 # 5.5.0
 2024-08-06 (Date of Last Commit)
 
diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 0ecb33aa2..d647e8294 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -9,7 +9,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.5.0"
+    String pipeline_version = "5.6.0"
 
 
     input {
@@ -179,7 +179,7 @@ workflow Multiome {
         File fragment_file_atac = JoinBarcodes.atac_fragment_tsv
         File fragment_file_index = JoinBarcodes.atac_fragment_tsv_tbi
         File snap_metrics_atac = JoinBarcodes.atac_h5ad_file
-        File atac_library_metrics = Atac.library_metrics
+        File atac_library_metrics = Atac.library_metrics_file
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version
diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
index e9da183ec..ba4a05376 100644
--- a/pipelines/skylab/paired_tag/PairedTag.changelog.md
+++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,3 +1,8 @@
+# 1.6.0
+2024-08-02 (Date of Last Commit)
+
+* Updated the SnapATAC2 docker to include v2.7.0; the pipeline will now produce a library-level summary metric CSV for the BAM.
+
 # 1.5.0
 2024-08-06 (Date of Last Commit)
 
diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl
index e35a153de..4206f4fab 100644
--- a/pipelines/skylab/paired_tag/PairedTag.wdl
+++ b/pipelines/skylab/paired_tag/PairedTag.wdl
@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.5.0"
+    String pipeline_version = "1.6.0"
 
 
     input {
@@ -149,6 +149,7 @@ workflow PairedTag {
     
     File atac_fragment_out = select_first([ParseBarcodes.atac_fragment_tsv,Atac_preindex.fragment_file])
     File atac_h5ad_out = select_first([ParseBarcodes.atac_h5ad_file, Atac_preindex.snap_metrics])
+    
     output {
         
         String pairedtag_pipeline_version_out = pipeline_version
@@ -157,6 +158,7 @@ workflow PairedTag {
         File bam_aligned_output_atac = Atac_preindex.bam_aligned_output
         File fragment_file_atac = atac_fragment_out
         File snap_metrics_atac = atac_h5ad_out
+        File atac_library_final = Atac_preindex.library_metrics_file
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version

From 45bf059f0effc06e1a66624810411eb4ccc930c4 Mon Sep 17 00:00:00 2001
From: GitHub Action <action@github.com>
Date: Thu, 29 Aug 2024 16:47:21 +0000
Subject: [PATCH 13/18] Updated pipeline_versions.txt with all pipeline version
 information

---
 pipeline_versions.txt | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index f8a8c4a1a..a01deead2 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -1,8 +1,8 @@
 Pipeline Name	Version	Date of Last Commit
 Optimus	 7.6.0	2024-08-06 
-Multiome	 5.5.0	2024-08-06 
-PairedTag	 1.5.0	2024-08-06 
-atac	 2.2.3	2024-08-02 
+Multiome	 5.6.0	2024-08-02 
+PairedTag	 1.6.0	2024-08-02 
+atac	 2.3.0	2024-08-29 
 SlideSeq	 3.4.0	2024-08-06 
 snm3C	 4.0.4	2024-08-06 
 MultiSampleSmartSeq2SingleNucleus	 1.4.2	2024-08-25-02 

From 63f5b1988d79b7d76a198252e6bc913a7d69302e Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 12:58:18 -0400
Subject: [PATCH 14/18] Update README.md

---
 pipelines/skylab/paired_tag/README.md | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/paired_tag/README.md b/pipelines/skylab/paired_tag/README.md
index b00f015d6..97a801a49 100644
--- a/pipelines/skylab/paired_tag/README.md
+++ b/pipelines/skylab/paired_tag/README.md
@@ -1,6 +1,6 @@
 ## Announcing a new site for WARP documentation!
 
-Paired-tag documentation has moved! Read more about the [Paired-Tag workflow](https://broadinstitute.github.io/warp/docs/Pipelines/PairedTag_Pipeline/README) on the new [WARP documentation site](https://broadinstitute.github.io/warp/)!
+Paired-tag documentation has moved! Read more about the [Paired-Tag workflow](https://broadinstitute.github.io/warp/docs/Pipelines/PairedTag_Pipeline/README) on the new [WARP documentation site](https://broadinstitute.github.io/warp/)! 
 
 ### Paired-Tag summary
 

From 0eb8920bd4dd8d204ad7c5dd85be58dc14ce084c Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Thu, 29 Aug 2024 14:06:55 -0400
Subject: [PATCH 15/18] fixed docker version

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index bc4d0c11f..a1b19acdb 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -58,7 +58,7 @@ workflow ATAC {
   String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919"
   String samtools_docker = "samtools-dist-bwa:3.0.0"
   String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311"
-  String snap_atac_docker = "snapatac2:lk-PD-2738"
+  String snap_atac_docker = "snapatac2:1.1.0"
 
   # Make sure either 'gcp' or 'azure' is supplied as cloud_provider input. If not, raise an error
   if ((cloud_provider != "gcp") && (cloud_provider != "azure")) {

From aad3ddcc8dd8124d352780fc83a4643ec3331b38 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Fri, 6 Sep 2024 08:37:10 -0400
Subject: [PATCH 16/18] updating memory on CreateFragment to 64 GB

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index a1b19acdb..b207e393f 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -507,7 +507,7 @@ task CreateFragmentFile {
     File annotations_gtf
     Boolean preindex
     Int disk_size = 500
-    Int mem_size = 16
+    Int mem_size = 64
     Int nthreads = 4
     String cpuPlatform = "Intel Cascade Lake"
     String docker_path

From d8aa1b20768d30866169c5b9fdf06cd15508f625 Mon Sep 17 00:00:00 2001
From: GitHub Action <action@github.com>
Date: Fri, 6 Sep 2024 12:37:34 +0000
Subject: [PATCH 17/18] Updated pipeline_versions.txt with all pipeline version
 information

---
 pipeline_versions.txt | 46 +++++++++++++++++++++----------------------
 1 file changed, 23 insertions(+), 23 deletions(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index a01deead2..4d1205506 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -1,42 +1,42 @@
 Pipeline Name	Version	Date of Last Commit
-Optimus	 7.6.0	2024-08-06 
-Multiome	 5.6.0	2024-08-02 
+MultiSampleSmartSeq2SingleNucleus	 1.4.2	2024-08-25-02 
+MultiSampleSmartSeq2	 2.2.21	2023-04-19 
 PairedTag	 1.6.0	2024-08-02 
+Optimus	 7.6.0	2024-08-06 
 atac	 2.3.0	2024-08-29 
-SlideSeq	 3.4.0	2024-08-06 
 snm3C	 4.0.4	2024-08-06 
-MultiSampleSmartSeq2SingleNucleus	 1.4.2	2024-08-25-02 
-scATAC	 1.3.2	2023-08-03 
 SmartSeq2SingleSample	 5.1.20	2023-04-19 
+Multiome	 5.6.0	2024-08-02 
+scATAC	 1.3.2	2023-08-03 
 BuildIndices	 3.0.0	2023-12-06 
-MultiSampleSmartSeq2	 2.2.21	2023-04-19 
-CEMBA	 1.1.6	2023-12-18 
+SlideSeq	 3.4.0	2024-08-06 
 BuildCembaReferences	 1.0.0	2020-11-15 
-UltimaGenomicsWholeGenomeCramOnly	 1.0.20	2024-08-02 
+CEMBA	 1.1.6	2023-12-18 
 GDCWholeGenomeSomaticSingleSample	 1.3.2	2024-08-02  
-ExomeGermlineSingleSample	 3.1.22	2024-06-12 
-UltimaGenomicsWholeGenomeGermline	 1.0.20	2024-08-02 
-WholeGenomeGermlineSingleSample	 3.2.1	2024-06-12 
-VariantCalling	 2.2.1	2024-06-12 
+UltimaGenomicsWholeGenomeCramOnly	 1.0.20	2024-08-02 
+JointGenotypingByChromosomePartOne	 1.4.12	2023-12-18 
+JointGenotypingByChromosomePartTwo	 1.4.11	2023-12-18 
 UltimaGenomicsJointGenotyping	 1.1.7	2023-12-18 
 JointGenotyping	 1.6.10	2023-12-18 
 ReblockGVCF	 2.2.1	2024-06-12 
-JointGenotypingByChromosomePartTwo	 1.4.11	2023-12-18 
-JointGenotypingByChromosomePartOne	 1.4.12	2023-12-18 
-ExternalExomeReprocessing	 3.2.2	2024-08-02 
-ExternalWholeGenomeReprocessing	 2.2.2	2024-08-02 
-ExomeReprocessing	 3.2.2	2024-08-02 
-CramToUnmappedBams	 1.1.3	2024-08-02 
-WholeGenomeReprocessing	 3.2.2	2024-08-02 
-IlluminaGenotypingArray	 1.12.21	2024-08-02 
-Arrays	 2.6.27	2024-08-02 
-MultiSampleArrays	 1.6.2	2024-08-02 
+VariantCalling	 2.2.1	2024-06-12 
+WholeGenomeGermlineSingleSample	 3.2.1	2024-06-12 
+UltimaGenomicsWholeGenomeGermline	 1.0.20	2024-08-02 
+ExomeGermlineSingleSample	 3.1.22	2024-06-12 
 ValidateChip	 1.16.5	2024-08-02 
+Arrays	 2.6.27	2024-08-02 
 Imputation	 1.1.13	2024-05-21 
-RNAWithUMIsPipeline	 1.0.16	2023-12-18 
+MultiSampleArrays	 1.6.2	2024-08-02 
 BroadInternalUltimaGenomics	 1.0.21	2024-08-02 
 BroadInternalArrays	 1.1.11	2024-08-02 
 BroadInternalImputation	 1.1.12	2024-08-02 
 BroadInternalRNAWithUMIs	 1.0.33	2024-08-02 
+CramToUnmappedBams	 1.1.3	2024-08-02 
+ExternalWholeGenomeReprocessing	 2.2.2	2024-08-02 
+ExternalExomeReprocessing	 3.2.2	2024-08-02 
+WholeGenomeReprocessing	 3.2.2	2024-08-02 
+ExomeReprocessing	 3.2.2	2024-08-02 
+IlluminaGenotypingArray	 1.12.21	2024-08-02 
 CheckFingerprint	 1.0.20	2024-08-02 
 AnnotationFiltration	 1.2.5	2023-12-18 
+RNAWithUMIsPipeline	 1.0.16	2023-12-18 

From 1d67da79fc69cdffc234a55f251dc47a9253c078 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Fri, 6 Sep 2024 09:00:43 -0400
Subject: [PATCH 18/18] Update atac.changelog.md

---
 pipelines/skylab/atac/atac.changelog.md | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
index 1207b32c1..544fb8ea5 100644
--- a/pipelines/skylab/atac/atac.changelog.md
+++ b/pipelines/skylab/atac/atac.changelog.md
@@ -1,7 +1,9 @@
 # 2.3.0
 2024-08-29 (Date of Last Commit)
 
-* Updated the SnapATAC2 docker to include v2.7.0; the pipeline will now produce a library-level summary metric CSV for the BAM.  
+* Updated the SnapATAC2 docker to include v2.7.0; the pipeline will now produce a library-level summary metric CSV for the BAM. 
+
+* Updated the memory for the CreateFragmentFile task
 
 # 2.2.3
 2024-08-02 (Date of Last Commit)